vdsstream VDS - Research Page- Larry

Larry's Research
Summer 2012
Week of 7/16/12
-In order to verify the primer overlap assembly, we will try to send to sequencing
-Last week some of the PCR squared used for the last transformation was sent to sequencing, but results were crappy
BLAST results for sequence check of PCR squared from week of 070912.png

BLAST results for sequence check of PCR squared from week of 070912.png

-Really poor coverage, however within that coverage is highly conserved matches
-This could mean that the primers are failing to anneal correctly when sequencing
-It could also mean that the oligonucleotides primers are not forming the correct gene. However, this is unlikely since the gel check of PCR squared indicates the correctly sized gene

-Want to perform PCR squared, but ran out of 2ndary PCR, so made more

Andrew's primary and secondary PCR and my secondary PCR checked on agarose gel

Lane 1: skip
Lane 2: 1kb Ladder
Lane 3: Andrew's primary PCR
Lane 4: Andrew's secondary PCR
Lane 5-6: Larry's secondary PCRs
-I ran double the amount of PCR squared since I ran out of the last supply of 2ndary PCR quickly
-Both samples look like they worked

-Ran PCR squared in preparation for gel extraction, so 8 50ul samples were made

Lane 1: skip
Lane 2: 1kb Ladder
Lane 3-10: PCR squared
-PCR squared looks successful, will proceed with gel extraction

-Performed gel extraction
-Had 1.86g of gel

Nanodrop of gel extracted GAPDH, after PCR cleanup

-High concentration of GAPDH
-Good 260/280 and 260/230 ratios indicates low contamination
-Will use this to clone

-Cut pNIC-Bsa4

Lane 1: Skip
Lane 2: 1 kb Ladder
Lane 3: RE Digest of pNIC-Bsa4 with BsaI (AB)
Lane 4: RE Digest of pNIC-Bsa4 with BsaI (YH)
Lane 5: Skip
Lane 6: PCR Clean Up (KR)
Lane 7: PCR Clean Up (KR)
Lane 8: RE Digest of pNIC-Bsa4 with BsaI (KR)
Lane 9: pFAL (KR)
-The 4th lane indicates a successful pNIC-Bsa4 cut

Week of 7/9/12
-Results of sequencing are in

NNNNNNNTTNACTTTAGNNGAGANNTACATATGCACCATCATCATCATCATTCTTCTGGTGTAGATCTGGGTACCGAGAA
CCTGTACTTCCAATCCATGGCGGTTCGTGAACTGCCGGGTGCGTGGAACTTCCGCGACGTGGCTGACACCGCGACCGCGC
TGCGTCCGGGTCGTCTGTTCCGTAGCTCTGAACTGTCTCGTCTCGATGATGCCGGTCGTGCCACCCTGCGCCGTCTGGGT
ATCACCGACGTTGCCGATCTCCGCTCTTCCCGTGAAGTTGCTCGTCGTGGTCCAGGTCGTGTTCCAGATGGTATCGACGT
TCACCTGCTGCCGTTTCCTGATCTCGCGGACGATGACGCGGATGACTCTGCGCCTCACGAAACCGCATTCAAACGTCTGC
TGACCAACGACGGCTCTAATGGCGAATCTGGTGAATCTTCTCAGTCTATCAATGATGCAGCCACTCGTTACATGACCGAC
GAATATCGTCAATTCCCGACCCGTAATGGTGCGCAGCGTGCCCTGCATCGTGTTGTAACCCTCCTGGCCGCTGGCCGTCC
GGTTCTGACCCACTGCTTTGCGGGTAAAGACCGTACCGGCTTCGTTGTTGCACTGGTTCTGGAAGCGGTTGGTCTGGATC
GTGACGTAATTGTGGCGGACTACCTCCGTTCTAACGACAGCGTTCCGCAACTGCGTGCGCGTATCTCTGAAATGATCCAG
CAGCGTTTCGACACCGAACTGGCACCGGAGGTTGTTACCTTCACCAAAGCGCGTCTGTCTGACGGCGTTCTCGGTGTTCG
TGCGGAATACCTGGCAGCGGCTCGTCAAACCATCGACGAAACTTACGGNTCTCTGGGTGGTTACCTGCGTGATGCGGGCA
TCTCTCNNGCNACCGTTAACCGTATGCGTGGTGNTCTCCTGGGTTAACAGTAAAGGNGGATANGNATCCGAATTCGAGCT
CCGTCGACAAGCTTGCGGCNCACTCNAGCACCACACCACCNCCACTGAGATCCGGCTGCTAACAAGCCCGAANGNAGCTG
ANTTGGNTGCTGCACNNTGANCAANANTAGNATANNCNTNGGGNNNNNACGGGTCTGAGGGNTTTTNNTNANNNNNGANN
NNNNNCCGNATGGNNANGGGNNNNNCNNNNNNNNNNTNANNNNNNNNNNNNNNNNNNNNNNNANNNGNNCNNNNNNNNNN
NNNNNNNANNNNNN

-All 8 results are similar to this
-When blasted, there is no similarity to my gene, or to any gene in the complete database
-Did a blast on my entire virtual plasmid
-The sequence shares ends with the virtual plasmid, so it means that something did get transformed
-However, the stuff inserted is junk
-This may be an issue with purity
-Will attempt gel extraction to improve purity

Gel extraction:
-Forgot to take a picture of the gel, but PCR squared was successful
-Have the concentration

Concentration of Gel Extraction on PCR squared of tbGAPDH

-With a concentration as low as 37ng/ul, this sample won't be useful since PCR cleanup will remove too much DNA
-The 260/230 ratio of .09 indicates much contamination, so we can't just use this for transformation

Week of 7/2/12
-Attempted transformation into DH5alpha again

tbGAPDH in pNIC-Bsa4 in DH5alpha on kan+suc plate

-Transformation looks successful, each of these colonies must have the sacB gene disrupted
-Hopefully tbGAPDH is what disrupted sacB
-Colonies lookin good =D

-Selected 8 of the colonies for masterplate
-Grew up and did miniprep
-Found concentration of all 8 samples

Sample 1 of 8 miniprepped tbGAPDH in pNIC-Bsa4

-There are 7 other samples, but the concentration is similar.
-Graphs suggest there is DNA, but we don't know for sure if it's the correct gene

-Sent the plasmid to sequencing
-While waiting, I did an RE digest using BsaI, but it failed

Week of 6/25 -- Looks good Larry. -- Dr. B
-Cut pNIC-Bsa4 as the first step in cloning

pNIC-Bsa4 cut using BsaI and after PCR cleanup.

-Very low concentration after the cut, so it looks like it failed.

-Reran the cut
-However, ran out of material to Nanodrop since I had to use all of the material for the cohesive end generation (since I messed up pipetting)
-Did run a gel beforehand

pNIC-Bsa4 cut using BsaI but before PCR cleanup

Lane 1: skip
Lane 2: 1kb ladder
Lane 3: Andrew B's cut
Lane 4: Larry's cut of pNIC-Bsa4 using BsaI
-The cut looks successful since there are 2 major bands
-The large band at the top of lane 4 is probably uncut plasmid

-Proceded to cohesive end generation/ligation, but I failed to grow up any colonies, so will restart cloning.
-Performed another cut

Save Cancel pNIC-Bsa4 cut using BsaI and after PCR cleanup.

-Looks to be much more successful than the 1st attempt

Week of 6/18
-Did a test of 6 KOD hotstart polymerases using pNIC-Bsa4 and pLIC primers.
-Used this protocol

1% agarose gel, ethidium bromide

Lane 1: skip
Lane 2: 1kb Ladder
Lane 3-8: KOD hotstart polymerase A-F
Lane 9: Neg. control
-Negative control did not work
-Bands are at about 2kb, which is nearly the correct size pNIC-Bsa4
-Tube E did not work, so don't use that one!

Did primary and secondary PCR
-Used sticky ends with the custom primers

1% agarose gel, ethidium bromide

Lane 1: skip
Lane 2: 1kb ladder
Lane 3: primary pcr
Lane 4: secondary PCR
-Very bright band at about 1kb confirms the success of the primer overlap assembly.

Nanodropped the 2 PCR cleanup samples

-Blanked using 10mM Tris ph 8.0
-Concentrations of tbGAPDH gene is a little low
-May be difficult to get the gene cloned

Ran PCR squared through an agarose gel

1% agarose gel, ethidium bromide

Lane 1: skip
Lane 2: 1kb Ladder
Lane 3: PCR Squared
-the PCR squared seems to be at the 1kb mark, so it looks successful.

Week 14

Instead of trying to continue expression (since this is the last week), I did a two assays for yoph.
When doing the enzyme concentration assay, I used a very high working enzyme concentration, but the assay still worked

Varying amounts of the enzyme YopH assayed with pNPP plotted against absorbance. Dark blue point indicates the optimal concentration for vary substrate assay.

YopH assayed with varying amounts of substrate pNPP plotted against absorbance.

The substrate assayed failed, since there is supposed to be a curve upwards, then a plateau.

Week 13 (Thanksgiving week)

Tried to grow up more BL21 for expression, but using an altered procedure.
- Instead of growing an initial amount in 50ml of LB then transferring them the next day for spectrophotometry, the spectrophotometry would be done on the 50ml and after the OD was 0.3, IPTG would be added and then transferred to a large 2L flask for overnight growth
- However, the OD600 would not go up even after measuring for a few hours
Tried to grow the BL21 using the normal procedure, but once again the OD600 would not increase. However this may be because I added the kanamycin 20 minutes after it I put it in the incubator.

Week 12

Started purification
During the pH adjustment step, I used 5M NaOH and completely overshot the target pH. Then I tried to use concentrated HCl to counteract the NaOH, but this caused the protein to precipitate, making it unusable

Cloudy solution indicates protein precipitate. mmmmm creamy...

Started a shortened version of expression, where the initial 50ml growth is used the same day as the 500ml growth.
Grew up the bacteria in 50ml until OD600 was around 1.0

Week 11

Started Expression
Pellet weighed 2.5 grams

Time	OD600
1:27	.093
1:55	.063
2:35	.121
3:00	.191
3:27	.197
3:56	.267
4:18	.28

The OD600 at 3:27 must have been an error in measurement
Stopped at .28 absorbance since it looked like the growth was starting to plateau

Week 10

Tried to do transformation again but no colonies grew on the master plate
Decided to use Justin's BL21 colonies and proceed to expression

Week 9

Only one colony had any results, but there were deletions
Started 2nd runs of HF9 and MW libraries

Week 8

Selected colonies onto a master plate
Grew up colonies and performed miniprep
Only three colonies grew

Nanodrop of the three colonies that grew.

Also began virtual screening of PP2Ctg
Queued HF9 and MW libraries

Week 7

Inserted PP2Ctg into pNIC-bsa4
Transformed plasmid into the bacteria

Plates of Kan+Sucrose. Plate A (left) has 4 ul of treated insert and Plate B (right) has 8 ul of treated insert.

Week 6

Performed primary, secondary PCR, and PCR squared

Gel_Check_PCR',_PCR'',_and_PCR_squared.png

PCR squared looks successful

The yield from these four combined PCR squared is very high

Week 5

Performed PCR Squared
Performed a gel check (since primary/secondary was left out overnight...)
Found that everything broke down

Lane 1: skip
Lane 2: 100bp Ladder
Lane 3-4: PCR squared

Week 4

Did a gel check on the prep of pNIC-Bsa4 as accepting vector and the Gel extraction of the contaminated PCR squared

Going from right to left:
Lane 1: Skip
Lane 2: 100bp Ladder
Lane 3: Gel extracted PCR squared
Lane 4: 1kb Ladder
Lane 5: Preparation of pNIC-Bsa4 for cloning

The band from the gel extraction is extremely faint, so the gel extraction process probably lost most of the DNA
A nanodrop reading confirms that there is nothing of use from the extraction